>ABJ65965.1 contig_ID:CP000419.1 Gene_location:643235-646600 direction:+ Annotation:what=cas;des=cd09643:cas9;note=Subtype-II-A;Name=ABJ65965.1;gene=unk
ATGAGTGACTTAGTTTTAGGACTTGATATCGGTATAGGTTCTGTTGGTGTGGGTATCCTTAACAAAGTGA
CAGGAGAAATTATCCATAAAAACTCACGCATCTTCCCAGCAGCTCAAGCGGAAAATAACCTAGTACGTAG
AACGAATCGTCAAGGAAGACGCTTGGCACGACGTAAAAAACATCGTAGAGTTCGTTTAAATCGTCTATTT
GAGGAAAGTGGATTAATCACTGATTTTACGAAGATTTCAATTAATCTTAACCCATATCAATTACGAGTTA
AGGGCTTGACCGATGAATTGTCTAATGAAGAACTGTTTATCGCTCTTAAAAATATGGTGAAACACCGTGG
GATTAGTTACCTCGATGATGCTAGTGATGACGGAAATTCATCAGTAGGAGACTATGCACAAATTGTTAAG
GAAAATAGTAAACAATTAGAAACTAAGACACCGGGACAGATACAGTTGGAACGCTACCAAACATATGGTC
AATTACGTGGTGATTTTACTGTTGAGAAAGATGGCAAAAAACATCGCTTGATTAATGTCTTTCCAACATC
AGCTTATCGTTCAGAAGCCTTAAGGATACTGCAAACTCAACAAGAATTTAATCCACAGATTACAGATGAA
TTTATTAATCGTTATCTCGAAATTTTAACTGGAAAACGGAAATATTATCATGGACCCGGAAATGAAAAGT
CACGGACTGATTATGGTCGTTACAGAACGAGTGGAGAAACTTTAGACAATATTTTTGGAATTCTAATTGG
GAAATGTACATTTTATCCAGACGAGTTTAGAGCAGCAAAAGCTTCCTACACGGCTCAAGAATTCAATTTG
CTAAATGATTTGAACAATCTAACAGTTCCTACTGAAACCAAAAAGTTGAGCAAAGAACAGAAGAATCAAA
TCATTAATTATGTCAAAAATGAAAAGGCAATGGGGCCAGCGAAACTTTTTAAATATATCGCTAAGTTACT
TTCTTGTGATGTTGCAGATATCAAGGGATACCGTATCGACAAATCAGGTAAGGCTGAGATTCATACTTTC
GAAGCCTATCGAAAAATGAAAACGCTTGAAACCTTAGATATTGAGCAAATGGATAGAGAAACGCTTGATA
AATTAGCCTATGTCTTAACATTAAACACTGAGAGGGAAGGTATTCAAGAAGCCTTAGAACATGAATTTGC
TGATGGTAGCTTTAGCCAGAAGCAAGTTGACGAATTGGTTCAATTCCGCAAAGCAAATAGTTCCATTTTT
GGAAAAGGATGGCATAATTTTTCTGTCAAACTGATGATGGAGTTAATTCCAGAATTGTATGAGACGTCAG
AAGAGCAAATGACTATCCTAACACGACTTGGAAAACAAAAAACGACTTCGTCTTCAAATAAAACAAAATA
TATAGATGAAAAACTATTAACTGAAGAAATCTATAATCCTGTTGTTGCTAAGTCTGTTCGCCAGGCTATA
AAAATCGTAAATGCGGCGATTAAAGAATACGGAGACTTTGACAATATTGTCATCGAAATGGCTCGTGAAA
CAAATGAAGATGATGAAAAGAAAGCTATTCAAAAGATTCAAAAAGCCAACAAAGATGAAAAAGATGCAGC
AATGCTTAAGGCTGCTAACCAATATAATGGAAAGGCTGAATTACCACATAGTGTTTTCCACGGTCATAAG
CAATTAGCGACTAAAATCCGCCTTTGGCATCAGCAAGGAGAACGTTGCCTTTATACTGGTAAGACAATCT
CAATCCATGATTTGATAAATAATTCTAATCAGTTTGAAGTAGATCATATTTTACCTCTTTCTATCACATT
CGATGATAGCCTTGCAAATAAGGTTTTGGTTTATGCAACTGCTAACCAAGAAAAAGGACAACGAACACCT
TATCAGGCTTTAGATAGTATGGATGATGCGTGGTCTTTCCGTGAATTAAAAGCTTTTGTACGTGAGTCAA
AAACACTTTCGAACAAGAAAAAAGAATACCTCCTTACAGAAGAAGATATTTCAAAGTTTGATGTTCGAAA
GAAATTTATTGAACGAAATCTTGTAGATACAAGATACGCTTCAAGAGTTGTCCTCAATGCCCTTCAAGAA
CACTTTAGAGCTCACAAGATTGATACAAAAGTTTCCGTGGTTCGTGGCCAATTTACATCTCAATTGAGAC
GCCATTGGGGAATTGAGAAGACTCGTGATACTTATCATCACCATGCTGTCGATGCATTGATTATTGCCGC
CTCAAGTCAGTTGAATTTGTGGAAAAAACAAAAGAATACCCTTGTAAGTTATTCAGAAGACCAACTCCTT
GATATTGAAACAGGTGAACTTATTAGTGATGATGAGTACAAGGAATCTGTGTTCAAAGCCCCTTATCAAC
ATTTTGTTGATACATTGAAGAGTAAAGAATTTGAAGACAGTATCTTATTCTCTTATCAAGTGGATTCTAA
GTTTAATCGTAAAATATCAGATGCCACTATTTATGCGACAAGACAGGCTAAAGTAGGAAAAGATAAGGCG
GATGAAACTTATGTCTTAGGGAAAATCAAAGATATCTATACTCAGGATGGTTATGATGCCTTTATGAAGA
TTTATAAGAAGGATAAGTCAAAATTCCTCATGTATCGTCACGACCCACAAACCTTTGAGAAAGTTATCGA
GCCAATTTTAGAGAACTATCCTAATAAGCAAATAAATGAAAAAGGGAAAGAGGTACCATGTAATCCTTTC
CTAAAATATAAAGAAGAACATGGCTATATTCGTAAATATAGTAAAAAAGGCAATGGTCCTGAAATCAAGA
GTCTTAAATACTATGATAGTAAGCTAGGCAATCATATTGATATTACTCCGAAGGATAGTAACAATAAAGT
TGTCTTACAGTCAGTTTCTCCATGGAGAGCGGATGTCTATTTCAATAAGACTACTGGAAAATACGAAATC
CTCGGATTGAAATATGCTGATTTACAATTTGAAAAAGGGACAGGAACATATAAGATTTCCCAGGAAAAAT
ACAATGACATTAAGAAAAAAGAGGGTGTAGATTCTGATTCAGAATTCAAGTTTACACTTTATAAAAATGA
TTTGTTACTCGTTAAAGATACAGAAACAAAAGAACAACAGCTTTTCCGTTTTCTTTCTCGAACTATGCCT
AAACAAAAGCATTATGTTGAATTAAAACCTTATGATAAACAGAAATTTGAAGGAGGTGAGGCGTTAATTA
AAGTGTTGGGTAACGTTGCTAATAGTGGTCAATGCAAAAAAGGGCTAGGAAAATCAAATATTTCTATTTA
TAAGGTAAGAACAGATGTCCTAGGAAATCAGCATATCATCAAAAATGAGGGTGATAAGCCTAAGCTAGAT
TTTTAA
>ABJ65966.1 contig_ID:CP000419.1 Gene_location:646777-647688 direction:+ Annotation:what=cas;des=cd09720:cas1;note=Subtype-II-A;Name=ABJ65966.1;gene=unk
ATGACTTGGAGAGTTGTACATGTCAGTCAAAGCGAGAAGATGCGCTTAAAGCTTGATAACTTATTAGTGC
AAAAGATGGGACAAGAGTTTACGGTGCCACTAAGTGATATTTCGATAATCGTTGCAGAAGGTGGGGATAC
AGTTGTTACCCTTCGTCTATTAAGTGCCTTAAGTAAATATAATATTGCTTTAGTTGTTTGTGATAATGAA
CATTTACCAACAGGGATTTATCACTCACAAAATGGGCACTTTAGAGCGTACAAGCGCTTGAAAGAACAGC
TGGATTGGTCTCAGAAACAAAAGGACAAGGCATGGCAGATTGTAACTTATTATAAAATCAATAACCAAGA
GGATGTCCTAGCCATGTTTGAAAAAAGTCTGGACAACATTAGATTACTTTCAGACTATAAAGAGCAGATA
GAACCTGGTGATAGAACGAATAGAGAGGGACATGCTGCCAAGGTCTACTTTAATGAGCTCTTTGGTAAAC
AATTTGTCAGAGTAACTCAGAAAGAAGCTGATGTCATCAATGCTGGTTTAAACTATGGCTATGCTATCAT
GAGGGCTCAGATGGCTAGAATAGTGGCGGGTTATGGTTTAAATGGCCTATTAGGAATCTTCCATAAAAAT
GAATACAATCAGTTTAATTTGGTTGACGACTTGATGGAGCCATTTAGACAGATTGTAGATGTTTGGGTAT
ATGATAATCTACGAGATCAGGAATTCCTTAAGTATGAGTATAGGTTGGGATTGACAGATTTACTCAATGC
TAAAATCAAATATGGCAAAGAGACCTGTTCAGTGACAGTTGCTATGGACAAATATGTCAAAGGCTTTATC
AAATATATTTCGGAAAAAGATAGCAGTAAATTCCACTGCCCAGTGGTATCAAGTTTAGAGTGGAGAAAAT
AA
>ABJ65967.1 contig_ID:CP000419.1 Gene_location:647690-648013 direction:+ Annotation:what=cas;des=pfam09827:cas2;note=Subtype-II-A;Name=ABJ65967.1;gene=unk
ATGAGGTATGAAGCGTTGAGATTATTATGTTTTTTTGATTTACCAATGGAATCCAAGGATGAAAAAAGAA
TTTATCGTAATTTTCGTAAAGAATTAATTTCAAATGGGTTTGAAATGTTACAATTTTCGGTCTATTATCG
CACTTGTCCTAATAGAAGCTTTGCAAATAAATTTTATAAGAAGCTAAAGATGAGCAATCTGCCTGCTGGA
AATGTGAGACTTTTGGCGGTTACTGAAAAGCAATTTTCAGAGATGACATTAATTATAGGTGGCAAAACTA
AGCAAGAGGAAATCGTCAGTGATAATAAGTTGGTGGCCATATGA
>ABJ65968.1 contig_ID:CP000419.1 Gene_location:648010-649062 direction:+ Annotation:what=cas;des=cd12217:csn2;note=Subtype-II-A;Name=ABJ65968.1;gene=unk
ATGAAATTTTTTGTACGACATCCTTACAAAGATCGTATTGAATTGAATATCGGTGCAATCACACAAATTG
TTGGTCAAAATAATGAACTCAAATATTATATTTTGCAGATTTTGAGCTGGTATTTTGGTGGAAAAAAATA
CTCGAGAGAGGACTTAAGTATTTTTGATTATGAGGAGCCTACCATACTTGATGAGGCCAGAGAAATAGTG
AAACGAAGTAGCTATCACTATATCGACATTTCAACTTTTAAGGATTTACTGGAGCAGATGGAATACAAGA
AAGGAACACTTGCTCACGGTTACCTTCGTAAAATTGTCAATCAAGTTGATATTGTAGGCCATTTGGAGAA
AATTAATGAACAAGTAGAGCTTATTGAAGAAGCTATGAATCGGCATATAAACTTAAACTGTGGACAGGTG
GAATACCATTTGGAGAATCTCCCTCTAACACTAGACCAACTACTCACAAAAAATTTTAGCCCATTTTTTA
CCATTGAGAACAAGAATCTATCTTTTGAATGGGTTTCTAATATTGATAAACTATCCCTCTTTTTAGAAAT
GTTAGACCATCTTCTTTTACAAACAACAGAGAAGTATCTCATTGTGCTAAAAAATATTGATGGCTTTATC
TCAGAAGAATCTTATACTATTTTTTATAGGCAAATCTGTCATCTGGTCAAGAAGTATCCAAATCTAACCT
TTATTTTGTTTCCTAGTGACCAAGGCTATTTAAAAATTGATGAAGAAAATAGTAGGTTCGTCAATATTTT
ATCTGACCAGGTGGAGCATTTGTATGATGTTGAGTTTATGTATGAAAGGGTAATGAAATATTATCCAAGT
AATGATTTTCCGACGAGAGAAGGCTTTAGGATGTCTTTAGAAACTGTGACACCTTATTTATTGACAAAAA
TGCTGAGACAACCTAGTCTCTCACTTGTTGATTCAGTAATATTGAATATCCTAAATCAGTTGTTTCATTT
TAGTTACCGTATAAGATATTTACAAAAATCTGATGAAAAACTTTTACAGAAATTTTTAGAAAGTAAGGAT
TGA
>ABJ66187.1 contig_ID:CP000419.1 Gene_location:895636-896640 direction:+ Annotation:what=cas;des=cd09634:cas1;note=universal;Name=ABJ66187.1;gene=unk
ATGAGCGATTTATATAGTCAAAGGTCCAATTATTACCTGTCCTTATCTGAACAAAGAATTATCATTAAAA
ATGATAATAAAGAGATTGTCAAAGAAGTGTCCATTTCACTCGTTGATAATGTATTACTTTTTGGTAATGC
ACAACTGACCACCCAACTCATCAAAGCCTTATCAAAGAACAAGGTGAATGTTTACTATTTCTCAAATGTT
GGTCAATTTATTTCTAGTATTGAAACCCACAGGCAGGACGAATTCCAAAAGCAAGAGTTGCAAGCAAAGG
CTTATTTTGAAGAGGATTTTCGTTTAGAGGTTGCGAGGAGTATTGCTACGACCAAGGTGAGGCACCAAAT
TGCCTTACTTAGAGAGTTTGATACGGATGGTCTACTAGATACCTCAGATTATTCTAGGTTTGAAGATAGT
GTCAATGATATTCAGAAAGCTTATTCCATTACAGAAATTATGGGTTACGAAGGTCGCCTTGCGAAATCCT
ATTTTTACTATCTGAATTTACTCGTTCCTGATGACTTTCATTTTAATGGTAGGAGTAGACGGACTGCGGA
GGATTGTTTTAACAGTGCCCTCAATTTTGGCTATAGTATCTTATATTCTTGCTTAATGGGGCTGATTAAG
AAAAACGGGCTAAGCTTGGGATTTGGGGTAATTCACAAGCATCATCAGCATCATGCGACCTTGGCCAGTG
ATTTAATGGAAGAATGGAGACCTATCATCGTTGATAATACGCTTATGGAGTTGATACGAAATGGTAAACT
TCTTTTAAGTCATTTTGAAAATAAGGATCAAGACTTCATACTCACCGATGAAGGCAGAGAAATCTTTGCA
TGGGCTTTACGTTCAAGAATATTAGAAGTCCATCGGTATATTGAGTTAGACAAAAAACGCTATTCTTTTC
TTTATACAGCAGATAGGCAAATCAAGAGTTTGATTAGGGCTTTTAGAGAACTTGACCCTAGTCTCTATGA
GACAAGTTACACAGGAGGGCATTAA
>ABJ66188.1 contig_ID:CP000419.1 Gene_location:896640-896969 direction:+ Annotation:what=cas;des=cd09725:cas2;note=universal;Name=ABJ66188.1;gene=unk
ATGGGACTTTACTTTAACCTCAGCGAAGAAGAGCGTGAGTTTGCCAAACAAAAAACCATGTTTTGTCTGA
TTATTTATGATATCCGAAGTAACAAACGTAGACTTAAACTCTCGAAATTACTTGAGGGTTATGGCGTGAG
GGTGCAAAAATCCTGTTTCGAGGTCAACCTGTCAAGAAATGATTATCAGTCTCTCCTTAAGGATATCGAG
GGCTTCTACAAGGCTGATGAAGAAGACAGCATAATAGTGTATGTGACAACCAAAGAAGAGGTGACTAGTT
TTAGCCCCTACCATAGTGCTGAAAAATTAGATGACATTCTCTTCTTCTAA
>ABJ66189.1 contig_ID:CP000419.1 Gene_location:897458-898189 direction:+ Annotation:what=cas;des=cd09652:cas6;note=other;Name=ABJ66189.1;gene=unk
ATGAAAAAATTAGTATTTACTTTTAAAAGGATCGACCATCCTGCACAAGATTTGGCTGTTAAATTTCATG
GCTTCTTGATGGAGCAGTTGGATAGTGACTATGTTGATTATCTGCATCAGCAGCAAACAAATCCCTATGC
GACCAAGGTAATCCAAGGGAAAGAAAACACGCAGTGGGTTGTACATCTGCTCACAGACGACATCGAGGAT
AAGGTTTTTATGACCTTATTACAGATTAAAGAGGTGTCCTTAAACGATCTGCCTAAACTCAGTGTCGAAA
AAGTTGAGATTCAGGAGTTGGGGACAGATAAACTGTTAGAGATTTTCAATAGTGAGGAAAATCAAACCTA
TTTTTCAATTATTTTTGAGACTCCAACAGGTTTTAAATCTCAAGGTTCCTACGTCATCTTCCCGTCTATG
CGTTTGATTTTTCAAAGTTTGATGCAAAAGTATGGAAGGTTGGTTGAAAATCAACCTGAAATTGAAGAGG
ATACCTTAGATTACCTATCTGAACACAGCACTATCACGAATTATCGCTTGGAGACGAGTTATTTCAGGGT
GCACAGGCAACGAATTCCTGCCTTTAGAGGAAAGTTAACCTTTAAAGTACAAGGCGCCAAAACTCTAAAA
GCTTATGTCAAAATGCTTCTAACATTCGGTGAATATTCAGGTCTTGGCATGAAAACGAGTCTCGGTATGG
GAGGGATAAAGCTTGAAGAAAGAAAAGATTGA
>ABJ66190.1 contig_ID:CP000419.1 Gene_location:900443-900823 direction:+ Annotation:what=cas;des=cd09647:csm2gr11;note=Subtype-III-A;Name=ABJ66190.1;gene=unk
ATGACAATCTTGACTGATGAGAATTACGTTGATATTGCAGAAAAAGCAATTCTAAAACTAGAAAGAAATA
CAAGGAACAGAAAGAATCCTGATGCCTTCTTTCTTACAACAAGTAAGCTCAGAAACTTGCTGAGCTTAAC
TAGTACACTTTTTGATGAGAGTAAGGTCAAAGAATATGATGATCTCCTTGATCGTATTGCTTATTTAAGA
GTACAATTTGTCTATCAAGCAGGTAGAGAGATTGCAGTAAAAGATCTGATAGAAAAGGCTCAAATTCTTG
AGGCTCTTAAGGAAATCAAAGATAGAGAGACACTTCAAAGATTTTGTAGATATATGGAAGCATTAGTAGC
CTATTTCAAGTTTTATGGAGGTAAAGATTAA
>ABJ66191.1 contig_ID:CP000419.1 Gene_location:900823-901485 direction:+ Annotation:what=cas;des=COG1337:csm3gr7;note=Subtype-III-D;Name=ABJ66191.1;gene=unk
ATGACATTCGCTAAGATTAAATTTTCAGCTCAAATTCGTTTAGAGACAGGCCTCCATATTGGTGGAAGCG
ATGCTTTTGCAGCCATTGGTGCAATCGATTCGCCTGTTATTAAAGATCCTATTACCAACATACCGATCAT
TCCTGGTTCAAGTCTCAAAGGAAAAATGAGAACGCTTCTTGCCAAGGTTTATAATGAAAAAGTAGCTGAG
AAACCAAGCGATGACAGTGATATTCTTAGCCGTTTATTTGGGAATAGTAAAGATAAACGATTCAAAATGG
GACGCTTGATTTTTCGTGATGCCTTCTTGTCAAACGCTGATGAGCTAGACTCTCTTGGGGTAAGAAGTTA
TACAGAAGTAAAATTTGAAAATACAATTGACCGTATCACTGCCGAAGCTAATCCAAGACAAATTGAACGT
GCTATTCGTAACAGTACTTTTGATTTCGAGTTGATTTATGAAATTACAGATGAGAATGAAAATCAAGTCG
AAGAAGATTTCAAAGTGATTCGAGATGGTTTAAAACTGCTTGAACTTGATTATCTTGGTGGTTCTGGATC
TCGAGGTTACGGTAAGGTTGCTTTTGAAAAACTCAAAGCTACTACCGTATTTGGTAATTATGATGTTAAA
ACATTAAATGAACTTTTAACTGCGGAGGTCTAA
>ABJ66192.1 contig_ID:CP000419.1 Gene_location:901487-902386 direction:+ Annotation:what=cas;des=COG1567:csm4gr5;note=Subtype-III-A;Name=ABJ66192.1;gene=unk
ATGACCTATAAACTGTATATTATGACCTTTCAGAATGCTCATTTTGGTTCGGGCACTCTTGATAGCTCAA
AATTAACATTCTCAGCAGACCGTATCTTCTCAGCACTAGTGCTAGAATCCCTAAAAATGGGAAAACTCGA
TGCATTTCTTGCGGAAGCTAACCAAGACAAGTTCACGCTCACAGATGCCTTTCCATTTCAATTTGGTCCC
TTTTTGCCGAAACCTATTGGTTATCCCAAACATGACCAAATAGATCAATCAGTTGATGTCAAAGAGGTTC
GCCGTCAAGCAAAATTGTCTAAGAAACTGCAATTTCTTGCTCTAGAAAATGTTGACGATTATCTCAATGG
AGAGTTATTTGAAAATGAAGAGCATGCAGTCATTGATACTGTGACAAAAAATCAACCACATAAGGATGGC
AATCTTTATCAGGTAGCTACAACTAGATTTTCAAATGATACGTCGCTTTACGTCATCGCAAACGAATCTG
ATTTGCTTAATGAGTTGATGTCTAGTCTTCAGTATTCAGGTCTTGGTGGAAAGCGTTCAAGTGGTTTTGG
TCGTTTTGAGTTAGATATTCAAAATATCCCACTAGAATTGTCAGATAGACTGACTAAGAATCATTCAGAT
AAAGTGATGAGTCTTACGACAGCACTTCCTGTAGATGCTGACCTTGAAGAAGCAATGGAAGATGGACATT
ACTTATTAACTAAATCAAGTGGTTTTGCATTTAGTCATGCTACCAATGAGAATTATCGTAAGCAGGATCT
TTACAAATTTGCTTCTGGTTCAACTTTTAGTAAAACATTTGAAGGTCAGATTGTTGATGTGAGACCACTT
GATTTCCCTCATGCTGTTTTAAATTATGCTAAACCACTCTTCTTTAAATTGGAGGTATAA
>ABJ66193.1 contig_ID:CP000419.1 Gene_location:902389-903462 direction:+ Annotation:what=cas;des=cd09726:csm3gr7;note=Subtype-III-D;Name=ABJ66193.1;gene=unk
ATGAAAAATGACTATAGAACATTTAAATTAAGCCTCCTGACACTTGCTCCAATTCATATTGGTAATGGAG
AGAAGTATACCTCTAGAGAATTTATCTATGAAAATAAGAAGTTTTACTTTCCTGACATGGGGAAATTCTA
TAATAAAATGGTGGAGAAGAGGCTTGCTGAAAAGTTTGAAGCATTTCTAATTCAAACTCGTCCAAATGCA
CGTAATAATCGTCTTATTTCCTTCTTAAATGATAACCGAATTGCAGAGCGTTCTTTTGGAGGTTATAGTA
TCTCTGAAACAGGTTTAGAATCGGACAGAAATCCTAATTCAGCCGGAGCTATTAACGAAGTTAATAAATT
TATTCGAGATGCTTTTGGAAATCCCTACATTCCTGGTAGCTCACTAAAAGGTGCTATTCGTACCATTTTA
ATGAATACTACCCCTAAGTGGAATAATGAAAATGCTGTAAATGACTTTGGAAGATTTCCGAAAGAGAATA
AGAACCTTATCCCTTGGGGACCAAAAAAGGGAAAAGAATACGATGATTTGTTTAACGCAATTCGTGTGAG
TGATAGTAAGCCTTTTGATAATAAGAGTCTTATCTTAGTACAGAAATGGGATTATTCAGCGAAAACAAAT
AAAGCTAAACCACTTCCCTTGTATAGAGAATCAATCTCTCCATTAACAAAAATTGAATTTGAGATTACAA
CAACTACTGATGAAGCTGGAAGATTGATTGAAGAATTAGGTAAGAGAGCACAAGCGTTTTATAAAGACTA
TAAAGCATTTTTCCTATCTGAATTTCCTGATGATAAGATTCAAGCCAATCTACAATACCCAATTTATTTA
GGTGCGGGGAGCGGTGCTTGGACAAAGACTCTATTTAAGCAAGCTGATGGTATTTTACAAAGACGATACA
GTCGAATGAAAACTAAAATGGTTAAAAAAGGAGTTCTTAAGCTCACAAAAGCACCTCTTAAAACAGTTAA
GATTCCATCTGGTAATCATTCATTAGTCAAGAACCACGAGTCCTTTTATGAAATGGGAAAAGCTAATTTC
ATGATTAAGGAGATTGATAAATGA
>ABJ66194.1 contig_ID:CP000419.1 Gene_location:903459-903554 direction:+ Annotation:what=cas;des=unk;note=unknown;Name=ABJ66194.1;gene=unk
ATGAGAGTACTTATATCAGCTGTAGGTGACACAGACCCTTTTAGAAATTTTCATGATGGCGCCTTAATTC
ATATCAAACAAGAATATCGGTCATGA
>ABJ66195.1 contig_ID:CP000419.1 Gene_location:903661-904257 direction:+ Annotation:what=cas;des=cd09699:csm6;note=Subtype-III-A;Name=ABJ66195.1;gene=unk
TTGAAGAAAACTGCTCGAGATTTTATTGAGAAGTTTGATTATAAGGCGGCACTAGATATTCTAGACCAAT
TATCAGATTTCCCGAATTTAAAAAGTCTTAGAGAAGAAATCCGTGATGTTGTCAACTGTCTGTCTAAAAA
GAAAATCGCTTATATTCGTGAGAAACTATACGATTTTTCACGAGTTTTCAAAAATCAGTCTATTCTTTCA
GATATCCTATCGTTTCCTCTCGATGACTCCCAAGAGAAGGCTTTGAATTACTATTTGATGATTGATGTTT
TAAAAGAACGTGAGCATATTGCTGATGTCTTAATTAAGGCAAAATCACTAGCTGAATTTGTCATCGAAGA
AACCATCAAAAAAGATCATGAGGGCTTAATTGTATTTGATGGCAATCTGCCAAAACTTAATCCAAGTTTT
CCTGATAAAGTTGCTCACGGTTTGTCAGAAATTGATACGCGATTATTAAGTCGTAAGAAGTTAAAACAAC
TTTCTGAAAACTTGCAATTGCTTCTTGTTGATTGTTTGGGTATTGATTCAAGCTATTTTAACTACTATGA
CAAACAAAATAAAGAGCTTACAAAGATGCTTGAATAG
>ABJ66633.1 contig_ID:CP000419.1 Gene_location:1378116-1378775 direction:- Annotation:what=cas;des=cd09758:csn2;note=Subtype-II-A;Name=ABJ66633.1;gene=unk
ATGAACATTAATTTTTCGCTTTTAGATGAGCCTTTGGAGATTAACCAGGGAACAGTTCTCGTAATTGAGG
ATGTGAGTGTGTTTGCTCAGTTAGTCAAGGAATTCTATCAGTATGATGAACAATCGAATTTAACAATATT
TGATAGTAAAATAAGGAGTATAAGGTCCTCTGAATTACTTTTAATAACGGATATTTTAGGTTACGATATT
AATACTTCTCAGGTATTAAAGTTGCTTCACACAGATATTGTAAGCCAGTTGAATGATAAACCTGAAGTTA
GATCAGAAATAGATTCTTTGGTATCATTAATTACTGATATTATAATGGCAGAGTGTATAGAAAATGAACT
AGATATAGAGTATGATGAGATTACACTTTTAGAACTAATTAAAGCATTAGGTGTCAGAATCGAAACTAAG
TCTTGTACGGTTTTTGAAAAAATATTTGATATTTTACAGATTTTTAAATATTTAGTTAAAAAGAGAATTT
TAGTATTCGTCAATAGCTTGTCGTATTTTTCTAAAGATGAAATTTATCAAATCTTGGAATATACAAAGTT
ATCACAAGCTGATGTATTATTTTTGGAACCTAGACAGATTGAAGGGATTCAACAATTTATTTTAGACAAG
GATTATATTTTGATGCCCTATAATAACTAG
>ABJ66634.1 contig_ID:CP000419.1 Gene_location:1378765-1379109 direction:- Annotation:what=cas;des=cd09638:cas2;note=Subtype-II-A;Name=ABJ66634.1;gene=unk
ATGAGTTATAGATATATGCGAATGATATTAATGTTTGATATGCCAACAGATACTGCTGAAGAGAGGAAAG
CGTATCGTAAGTTTAGAAAGTTTCTTTTAAGTGAAGGTTTTATCATGCACCAGTTTTCGGTTTATAGTAA
ACTTTTGTTAAATAATACTGCAAATAAAGCAATGATTGGACGACTTAAGGCTAATAATCCTAAAAAAGGA
AATATAACAATACTAACAGTTACTGAAAAGCAATTTGCCCGTATGATTTATTTGTACGGAGATAAAAACA
CAAGTATTGCCAACTCAGACGAAAGATTAGTATTTTTAGGAGAAAACTATTGTGATGAACATTAA
>ABJ66635.1 contig_ID:CP000419.1 Gene_location:1379106-1379975 direction:- Annotation:what=cas;des=cd09720:cas1;note=Subtype-II-A;Name=ABJ66635.1;gene=unk
ATGGCAGGTTGGAGAACAGTAGTCGTAAACATACATTCTAAACTGTCATATAAGAATAATCACCTTATTT
TTAGAAACTCATATAAAACTGAGATGATTCATCTTTCTGAAATTGATATACTTTTATTGGAAACAACTGA
CATTGTATTGACTACTATGTTAGTGAAGAGATTAGTTGATGAAAATATTCTAGTTATTTTCTGTGATGAT
AAACGATTGCCGACAGCTTTTCTTACACCGTATTATGCACGTCATGATTCTAGTCTGCAAATAGCTAGAC
AAATTGCGTGGAAGGAAAATGTTAAATGTGAGGTATGGACTGCTATTATTGCGCAAAAGATATTGAATCA
ATCTTACTATTTGGGAGAATGTTCCTTCTTTGAGAAATCTCAATCTATTATGGAATTATATCATGGATTA
GAACGGTTTGATCCTAGTAATCGTGAGGGTCACTCTGCCAGAATTTATTTTAATACGCTTTTCGGTAATG
ATTTTACTAGGGAAAGTGATAATGATATCAATGCAGCGCTGGATTATGGTTATACCTTGTTATTGAGTAT
GTTTGCACGTGAGGTTGTCGTCTGTGGTTGTATGACACAAATTGGTTTAAAACATGCTAACCAGTTTAAT
CAATTTAACCTTGCTAGTGATATTATGGAGCCATTTAGGCCAATTATAGATAGAATTGTTTATCAAAATC
GACATAATAATTTCGTCAAAATCAAAAAAGAACTTTTTTCGATCTTTTCAGAAACCTATCTCTATAATGG
AAAAGAGATGTATTTATCAAACATTGTTAGTGATTATACAAAAAAAGTTATAAAAGCGTTAAATCAGTTA
GGTGAGGAAATTCCTGAATTTAGAATATGA
>ABJ66636.1 contig_ID:CP000419.1 Gene_location:1379975-1384141 direction:- Annotation:what=cas;des=cd09643:cas9;note=Subtype-II-A;Name=ABJ66636.1;gene=unk
ATGACTAAGCCATACTCAATTGGACTTGATATTGGAACGAATAGTGTTGGATGGGCTGTAACAACTGATA
ATTACAAGGTTCCGTCTAAAAAAATGAAAGTCTTAGGAAATACGAGTAAAAAGTATATCAAAAAGAACCT
GTTAGGTGTATTACTCTTTGACTCTGGAATCACAGCAGAAGGAAGAAGATTGAAGCGTACTGCAAGAAGA
CGTTATACTAGACGCCGTAATCGTATCCTTTATTTGCAGGAAATTTTTAGCACAGAGATGGCTACATTAG
ATGATGCTTTCTTTCAAAGACTTGACGATTCGTTTTTAGTTCCTGATGATAAACGTGATAGTAAGTATCC
GATATTTGGAAACTTAGTAGAAGAAAAAGCCTATCATGATGAATTTCCAACTATCTATCATTTAAGGAAA
TATTTAGCAGATAGTACTAAAAAAGCAGATTTGCGTCTAGTTTATCTTGCATTGGCTCATATGATTAAAT
ATAGAGGTCACTTCTTAATTGAAGGAGAGTTTAATTCAAAAAATAATGATATTCAGAAGAATTTTCAAGA
CTTTTTGGACACTTATAATGCTATTTTTGAATCGGATTTATCACTTGAGAATAGTAAACAACTTGAGGAA
ATTGTTAAAGATAAGATTAGTAAATTAGAAAAGAAAGATCGTATTTTAAAACTCTTCCCTGGGGAGAAGA
ATTCGGGGATTTTTTCAGAGTTTCTAAAGTTGATTGTAGGAAATCAAGCTGATTTTAGGAAATGTTTTAA
TTTAGACGAAAAAGCCTCCTTACATTTTTCCAAAGAAAGCTATGATGAAGATTTAGAGACTTTGTTAGGT
TATATTGGAGATGATTACAGTGATGTCTTTCTCAAAGCAAAGAAACTTTATGATGCTATTCTTTTATCGG
GTTTTCTGACTGTAACTGATAATGAGACAGAAGCACCTCTCTCTTCTGCTATGATAAAGCGATATAATGA
ACACAAAGAAGATTTAGCGTTACTAAAGGAATATATAAGAAATATTTCACTAAAAACGTATAATGAAGTA
TTTAAAGATGACACCAAAAATGGTTATGCTGGTTATATTGATGGAAAAACAAATCAGGAAGATTTCTACG
TATATCTAAAAAAACTATTGGCTGAATTTGAAGGTGCGGATTATTTTCTTGAAAAAATTGATCGAGAAGA
TTTTTTGAGAAAGCAACGTACATTTGACAATGGTTCGATACCATATCAGATTCATCTTCAAGAAATGAGA
GCAATTCTTGATAAGCAAGCTAAATTTTATCCTTTCTTGGCTAAAAATAAAGAAAGAATCGAGAAGATTT
TAACCTTCCGAATTCCTTATTATGTAGGTCCACTTGCGAGAGGGAATAGTGATTTTGCCTGGTCAATAAG
AAAACGAAATGAAAAAATTACACCTTGGAATTTTGAGGACGTTATTGACAAAGAATCTTCGGCAGAGGCC
TTCATTAATCGAATGACTAGTTTTGATTTGTATTTGCCAGAAGAGAAGGTACTTCCAAAGCATAGTCTCT
TATACGAAACTTTTAATGTATATAATGAATTAACAAAAGTTAGATTTATTGCCGAAAGTATGAGAGATTA
TCAATTTTTAGATAGTAAGCAGAAGAAAGATATTGTTAGACTTTATTTTAAAGATAAAAGGAAAGTTACT
GATAAGGATATTATTGAATATTTACATGCAATTTATGGGTATGATGGAATTGAATTAAAAGGCATAGAGA
AACAGTTTAATTCTAGTTTATCTACTTATCACGATCTTTTAAATATTATTAATGATAAAGAGTTTTTGGA
TGATAGTTCAAATGAAGCGATTATCGAAGAAATTATCCATACTTTGACAATTTTTGAAGATAGAGAGATG
ATAAAACAACGTCTTTCAAAATTTGAGAATATATTCGATAAATCCGTTTTGAAAAAGTTATCTCGTAGAC
ATTACACTGGCTGGGGTAAGTTATCTGCTAAGCTTATTAATGGTATTCGAGATGAAAAATCTGGTAATAC
TATTCTTGATTACTTAATTGATGATGGTATTTCTAACCGTAATTTCATGCAACTTATTCACGATGATGCT
CTTTCTTTTAAAAAGAAGATACAGAAAGCACAAATTATTGGTGACGAAGATAAAGGTAATATTAAAGAGG
TCGTTAAGTCTTTGCCAGGTAGTCCTGCGATTAAAAAAGGTATTTTACAAAGCATAAAAATTGTAGATGA
ATTGGTCAAAGTAATGGGAGGAAGAAAACCCGAGTCAATTGTTGTTGAGATGGCTCGTGAAAATCAATAT
ACCAATCAAGGTAAGTCTAATTCCCAACAACGCTTGAAACGTTTAGAAAAATCTCTCAAAGAGTTAGGTA
GTAAGATACTTAAGGAAAATATTCCTGCAAAACTTTCTAAAATAGACAATAACGCACTTCAAAATGATCG
ACTTTACTTATACTATCTTCAAAATGGAAAAGATATGTATACCGGAGATGATTTAGATATTGATAGATTA
AGTAATTATGATATTGATCATATTATTCCTCAAGCTTTTTTGAAAGATAATTCTATTGACAATAAAGTAC
TTGTTTCATCTGCTAGTAACCGTGGTAAATCAGATGATGTTCCAAGTTTAGAGGTTGTCAAAAAAAGAAA
GACATTTTGGTATCAATTATTGAAATCAAAATTAATTTCTCAACGAAAATTTGATAATCTGACAAAAGCT
GAACGGGGAGGATTGTCACCTGAGGACAAAGCTGGTTTTATTCAACGCCAGTTGGTTGAAACACGTCAAA
TAACAAAACATGTAGCTCGTTTACTTGATGAGAAATTTAATAATAAAAAAGATGAAAATAATAGAGCGGT
ACGAACAGTAAAAATTATTACCTTGAAATCTACCTTAGTTTCTCAATTTCGTAAGGATTTTGAACTTTAT
AAAGTTCGTGAAATCAATGATTTTCATCATGCTCATGATGCTTACTTGAATGCCGTTGTAGCAAGTGCTT
TACTTAAGAAATACCCTAAACTAGAGCCAGAATTTGTGTACGGTGATTATCCAAAATACAATAGTTTTAG
AGAAAGAAAGTCCGCTACAGAAAAGGTATATTTCTATTCAAATATCATGAATATCTTTAAAAAATCTATT
TCTTTAGCTGATGGTAGAGTTATTGAAAGACCACTTATTGAGGTAAATGAGGAGACCGGCGAATCCGTTT
GGAATAAAGAATCTGATTTAGCAACTGTAAGGAGAGTACTCTCTTATCCGCAAGTAAATGTTGTGAAAAA
AGTTGAGGAACAGAATCACGGATTGGATAGAGGAAAACCAAAGGGATTGTTTAATGCAAATCTTTCCTCA
AAGCCAAAACCAAATAGTAATGAAAATTTAGTAGGTGCTAAAGAGTATCTTGACCCCAAAAAGTATGGGG
GGTATGCTGGAATTTCTAATTCTTTTACTGTTCTTGTTAAAGGGACAATTGAAAAAGGTGCTAAGAAAAA
AATAACAAATGTACTAGAATTTCAAGGTATTTCTATTTTAGATAGGATTAATTATAGAAAAGATAAACTT
AATTTTTTACTTGAAAAAGGTTATAAAGATATTGAGTTAATTATTGAACTACCTAAATATAGTTTATTTG
AACTTTCAGATGGTTCACGTCGTATGTTGGCTAGTATTTTGTCAACGAATAATAAGAGGGGAGAGATTCA
CAAAGGAAATCAGATTTTTCTTTCACAGAAGTTTGTGAAATTACTTTATCATGCTAAGAGAATAAGTAAC
ACAATTAATGAGAATCATAGAAAATATGTTGAGAACCATAAAAAAGAGTTTGAAGAATTATTTTACTACA
TTCTTGAGTTTAATGAGAATTATGTTGGAGCTAAAAAGAATGGTAAACTCTTAAACTCTGCCTTTCAATC
TTGGCAAAATCATAGTATAGATGAACTCTGTAGTAGTTTTATAGGACCTACCGGAAGTGAAAGAAAGGGG
CTATTTGAATTAACCTCTCGTGGAAGTGCTGCTGATTTTGAATTTTTAGGTGTTAAAATTCCAAGGTATA
GAGACTATACCCCATCATCCCTATTAAAAGATGCCACACTTATTCATCAATCTGTTACAGGCCTCTATGA
AACACGAATAGACCTTGCCAAACTAGGAGAGGGTTAA