##gff-version 3
#!processor CRISPRone
CP000419.1	Genbank	region	1	1856368	.	+	.	ID=CP000419.1;array=3;gene=16;type=(type II, III)
CP000419.1	FGS-hmm	CDS	643235	646600	.	+	.	what=cas;des=cd09643:cas9;note=Subtype-II-A;Name=ABJ65965.1;gene=unk
CP000419.1	CRISPRone	partial_repeat	646666	646704	.	+	.	what=antiCRISPR;des=antiRepeat:eat;note=31-5
CP000419.1	FGS-hmm	CDS	646777	647688	.	+	.	what=cas;des=cd09720:cas1;note=Subtype-II-A;Name=ABJ65966.1;gene=unk
CP000419.1	FGS-hmm	CDS	647690	648013	.	+	.	what=cas;des=pfam09827:cas2;note=Subtype-II-A;Name=ABJ65967.1;gene=unk
CP000419.1	FGS-hmm	CDS	648010	649062	.	+	.	what=cas;des=cd12217:csn2;note=Subtype-II-A;Name=ABJ65968.1;gene=unk
CP000419.1	metaCRT	direct_repeat	649125	650217	.	.	.	what=CRISPR;des=repeat:GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC;note=copy:17
CP000419.1	FGS-hmm	CDS	895636	896640	.	+	.	what=cas;des=cd09634:cas1;note=universal;Name=ABJ66187.1;gene=unk
CP000419.1	FGS-hmm	CDS	896640	896969	.	+	.	what=cas;des=cd09725:cas2;note=universal;Name=ABJ66188.1;gene=unk
CP000419.1	metaCRT	direct_repeat	897070	897331	.	.	.	what=CRISPR;des=repeat:GATATAAACCTAATTACCTCGAGAGGGGACGGAAACGCA;note=copy:4
CP000419.1	FGS-hmm	CDS	897458	898189	.	+	.	what=cas;des=cd09652:cas6;note=other;Name=ABJ66189.1;gene=unk
CP000419.1	FGS-hmm	CDS	900443	900823	.	+	.	what=cas;des=cd09647:csm2gr11;note=Subtype-III-A;Name=ABJ66190.1;gene=unk
CP000419.1	FGS-hmm	CDS	900823	901485	.	+	.	what=cas;des=COG1337:csm3gr7;note=Subtype-III-D;Name=ABJ66191.1;gene=unk
CP000419.1	FGS-hmm	CDS	901487	902386	.	+	.	what=cas;des=COG1567:csm4gr5;note=Subtype-III-A;Name=ABJ66192.1;gene=unk
CP000419.1	FGS-hmm	CDS	902389	903462	.	+	.	what=cas;des=cd09726:csm3gr7;note=Subtype-III-D;Name=ABJ66193.1;gene=unk
CP000419.1	FGS-hmm	CDS	903459	903554	.	+	.	what=cas;des=unk;note=unknown;Name=ABJ66194.1;gene=unk
CP000419.1	FGS-hmm	CDS	903661	904257	.	+	.	what=cas;des=cd09699:csm6;note=Subtype-III-A;Name=ABJ66195.1;gene=unk
CP000419.1	metaCRT	direct_repeat	1377229	1377794	.	.	.	what=CRISPR;des=repeat:GTTTTGGAACCATTCGAAACAACACAGCTCTAAAAC;note=copy:9
CP000419.1	FGS-hmm	CDS	1378116	1378775	.	-	.	what=cas;des=cd09758:csn2;note=Subtype-II-A;Name=ABJ66633.1;gene=unk
CP000419.1	FGS-hmm	CDS	1378765	1379109	.	-	.	what=cas;des=cd09638:cas2;note=Subtype-II-A;Name=ABJ66634.1;gene=unk
CP000419.1	FGS-hmm	CDS	1379106	1379975	.	-	.	what=cas;des=cd09720:cas1;note=Subtype-II-A;Name=ABJ66635.1;gene=unk
CP000419.1	FGS-hmm	CDS	1379975	1384141	.	-	.	what=cas;des=cd09643:cas9;note=Subtype-II-A;Name=ABJ66636.1;gene=unk
CP000419.1	CRISPRone	partial_repeat	1384328	1384363	.	-	.	what=antiCRISPR;des=antiRepeat:eat;note=27-9