##gff-version 3
#!processor CRISPRone
CP000419.1	Genbank	region	1	1856368	.	+	.	ID=CP000419.1
CP000419.1	FGS-hmm	CDS	72798	77192	.	+	.	what=cas;des=cd06127:DEDDh;note=Type-I;Name=ABJ65449.1;gene=unk
CP000419.1	FGS-hmm	CDS	198173	198616	.	+	.	what=cas;des=COG0640:csa3;note=Subtype-I-A;Name=ABJ65550.1;gene=unk
CP000419.1	FGS-hmm	CDS	415526	415969	.	+	.	what=cas;des=COG0640:csa3;note=Subtype-I-A;Name=ABJ65752.1;gene=unk
CP000419.1	metaCRT	direct_repeat	425198	425367	.	.	.	what=CRISPR;des=repeat:GCGCCAGCAGAACAACCAGCAGC;note=copy:4
CP000419.1	FGS-hmm	CDS	1254918	1255592	.	+	.	what=cas;des=cd09726:csm3gr7;note=Subtype-III-D;Name=ABJ66522.1;gene=unk
CP000419.1	FGS-hmm	CDS	1420563	1421843	.	-	.	what=cas;des=COG0640:csa3;note=Subtype-I-A;Name=ABJ66670.1;gene=unk
CP000419.1	FGS-hmm	CDS	1495864	1496649	.	-	.	what=cas;des=COG0640:csa3;note=Subtype-I-A;Name=ABJ66747.1;gene=unk