>AJJ47668.1 contig_ID:CP010103.1 Gene_location:568439-572341 direction:+ Annotation:what=cas;des=mkCas0192:cas12a;note=Subtype-V-A;Name=AJJ47668.1;gene=unk
ATGTCAATTTATCAAGAATTTGTTAATAAATATAGTTTAAGTAAAACTCTAAGATTTGAGTTAATCCCAC
AGGGTAAAACACTTGAAAACATAAAAGCAAGAGGTTTGATTTTAGATGATGAGAAAAGAGCTAAAGACTA
TAAAAAAGCTAAACAAATCATTGATAAATATCATCAGTTTTTTATAGAGGAGATATTAAGTTCGGTTTGT
ATCAGCGAAGATTTATTACAAAACTATTCTGATGTTTATTTTAAACTTAAAAAGAGTGATGATGATAATC
TACAAAAAGATTTTAAAAGTGCAAAAGATACGATAAAGAAACAAATATCTGAATATATAAAGGACTCAGA
AAAATTTAAGAATTTGTTTAATCAAAATCTTATAGATGCTAAAAAAGGGCAAGAGTCAGATTTAATTCTA
TGGCTAAAGCAATCTAAGGATAATGGCATAGAACTATTTAAAGCCAATAGTGATATCACAGACATAGATG
AGGCGTTAGAAATAATCAAATCTTTTAAAGGTTGGACAACTTATTTTAAGGGTTTTCATGAAAATAGAAA
AAATGTCTATAGTAGTGATGATATCCCTACATCTATTATTTATAGAATAGTAGATGATAATTTGCCTAAA
TTTCTAGAAAATAAAGCTAAGTATGAGAGTTTAAAAGACAAAGCTCCAGAAGCTATAAACTATGAACAAA
TTAAAAAAGATTTGGCAGAAGAGCTAACCTTTGATATTGACTACAAAACATCTGAAGTTAATCAAAGAGT
TTTTTCACTTGATGAAGTTTTTGAGATAGCAAACTTTAATAATTATCTAAATCAAAGTGGTATTACTAAA
TTTAATACTATTATTGGTGGTAAATTTGTAAATGGTGAAAATACAAAGAGAAAAGGTATAAATGAATATA
TAAATCTATACTCACAGCAAATAAATGATAAAACACTCAAAAAATATAAAATGAGTGTTTTATTTAAACA
AATTTTAAGTGATACAGAATCTAAATCTTTTGTAATTGATAAGTTAGAAGATGATAGTGATGTAGTTACA
ACGATGCAAAGTTTTTATGAGCAAATAGCAGCTTTTAAAACAGTAGAAGAAAAGTCTATTAAGGAAACAC
TATCTTTACTATTTGATGATTTAAAAGCTCAAAAACTTGATTTGAGTAAAATTTATTTTAAAAATGATAA
ATCTCTTACTGATCTATCACAACAAGTTTTTGATGATTATAGTGTTATTGGTACAGCGGTACTAGAATAT
ATAACTCAACAAGTAGCACCTAAAAATCTTGATAACCCTAGTAAGAAAGAGCAAGATTTAATAGCCAAAA
AAACTGAAAAAGCAAAATACTTATCTCTAGAAACTATAAAGCTTGCTTTAGAAGAATTTAATAAGCATAG
AGATATAGATAAACAGTGTAGGTTTGAAGAAATACTTGCAAACTTTGCGGCTATTCCGATGATATTTGAT
GAAATAGCTCAAAACAAAGACAATTTGGCACAGATATCTCTCAAATACCAAAATCAAGGTAAAAAAGACC
TACTTCAAGCTAGTGCAGAAGAAGATGTTAAAGCTATCAAGGATCTTTTAGATCAAACTAATAATCTCTT
GCATAGGCTAAAAATATTTCATATTAGTCAATCAGAAGATAAGGCAAATATTTTAGACAAGGATGAGCAT
TTTTATCTAGTATTTGAGGAGTGCTACTTTGAGCTAGCGAATATAGTGCCTCTTTATAACAAAATTAGAA
ACTATATAACTCAAAAGCCATATAGTGATGAGAAATTTAAGCTCAATTTTGAGAACTCAACTTTAGCTAA
TGGTTGGGATAAAAATAAAGAGCCTGACAATACGGCAATTTTATTTATCAAAGATGATAAATATTATCTG
GGTGTGATGAATAAGAAAAATAACAAAATATTTGATGATAAAGCTATCAAAGAAAATAAAGGTGAGGGTT
ATAAAAAAATTGTTTATAAACTTTTACCTGGTGCAAATAAAATGTTACCTAAGGTTTTCTTTTCTGCTAA
ATCTATAAAATTTTATAATCCTAGTGAAGATATACTTAGAATAAGAAATCATTCCACACATACAAAAAAT
GGTAATCCTCAAAAAGGATATGAAAAATTTGAGTTTAATATTGAAGATTGCCGAAAATTTATAGATTTTT
ATAAAGAGTCTATAAGTAAGCATCCAGAGTGGAAAGATTTTGGATTTAGATTTTCTGATACTCAAAGATA
TAATTCTATAGATGAATTTTATAGAGAAGTTGAAAATCAAGGCTACAAACTAACTTTTGAAAATATATCA
GAGAGCTATATTGATAGCGTAGTTAATCAGGGTAAATTGTACCTATTCCAAATCTATAATAAAGATTTTT
CAGCTTATAGCAAAGGGCGACCAAATCTACATACTTTATATTGGAAAGCGCTGTTTGATGAGAGAAATCT
TCAAGATGTGGTTTATAAGCTAAATGGTGAGGCAGAGCTTTTTTATCGTAAACAATCAATACCTAAAAAA
ATCACTCACCCAGCCAAAGAGGCAATAGCTAATAAAAACAAAGATAATCCTAAAAAAGAGAGTGTTTTTG
AATATGATTTAATCAAGGATAAACGCTTTACTGAAGATAAGTTTTTCTTTCACTGTCCTATTACAATCAA
TTTCAAATCTAGTGGAGCTAATAAGTTTAATGATGAAATCAATTTATTGCTAAAAGAAAAAGCAAATGAT
GTTCATATCCTAAGTATAGATAGAGGAGAAAGACATTTAGCTTACTATACTTTGGTAGATGGTAAAGGAA
ACATTATCAAACAAGATACTTTCAACATCATTGGTAATGATAGAATGAAAACAAACTACCATGATAAGCT
TGCTGCAATAGAGAAAGATAGGGATTCAGCTAGGAAAGACTGGAAAAAGATAAATAACATCAAAGAGATG
AAAGAGGGCTATCTATCTCAGGTAGTTCATGAAATAGCTAAGCTAGTGATAGAGCATAACGCTATTGTGG
TTTTTGAGGATTTAAATTTTGGATTTAAAAGAGGGCGTTTCAAGGTAGAGAAGCAGGTCTATCAAAAGTT
AGAAAAAATGCTAATTGAAAAGCTAAACTATTTAGTTTTCAAAGATAATGAGTTTGATAAAACTGGGGGA
GTGCTTAGAGCTTATCAGCTAACAGCACCTTTTGAGACTTTTAAAAAGATGGGTAAACAAACAGGTATTA
TCTACTATGTACCAGCTGGTTTTACTTCAAAAATTTGTCCTGTAACTGGTTTTGTAAATCAGTTATATCC
TAAGTATGAAAGTGTCAGCAAATCTCAAGAGTTCTTTAGTAAGTTTGACAAGATTTGTTATAACCTTGAT
AAGGGCTATTTTGAGTTTAGTTTTGATTATAAAAACTTTGGTGACAAGGCTGCCAAAGGCAAGTGGACTA
TAGCTAGCTTTGGGAGTAGATTGATTAACTTTAGAAATTCAGATAAAAATCATAATTGGGATACTCGAGA
AGTTTATCCAACTAAAGAGTTGGAGAAATTGCTAAAAGATTATTCTATCGAATATGGGCATGGCGAATGT
ATCAAAGCAGCTATTTGCGGTGAGAGCGACAAAAAGTTTTTTGCTAAGCTAACTAGTGTCCTAAATACTA
TCTTACAAATGCGTAACTCAAAAACAGGTACTGAGTTAGATTATCTAATTTCACCAGTAGCAGATGTAAA
TGGCAATTTCTTTGATTCGCGACAGGCGCCAAAAAATATGCCTCAAGATGCTGATGCCAATGGTGCTTAT
CATATTGGGCTAAAAGGTCTGATGCTACTAGATAGGATCAAAAATAATCAAGAGGGCAAAAAACTCAATT
TGGTTATCAAAAATGAAGAGTATTTTGAGTTCGTGCAGAATAGGAATAACTAA
>AJJ46892.1 contig_ID:CP010103.1 Gene_location:572449-573003 direction:+ Annotation:what=cas;des=cd09637:cas4;note=other;Name=AJJ46892.1;gene=unk
ATGGAAAATTATATTTTGATAACATGGTTAAATGATTTTATATTCTGTCCTTACTCGATATATTTGCATA
ATATCTATAGTAATGCGTCAGATACTACATACTATTCATCTAGCCAAACAAAAGGGCGCGATGCTCATAA
AAGTATCGATAAAGGAATCTATAGTACCAAAAAAGATGACCTGATCGGTATCGATGTTATTAACCATAAA
TATGGTTTGGTTGGTAAAATTGATGTTTTTCATAAAGATAAGGGCTTACTTGTGGAGAGAAAAAGGCAAA
TCAAGACTATCTATGATGGCTATAAATATCAGCTTTATGCGCAATATTTTTGTCTCCAAGAGATGGGCTA
TGATGTCAAAGCCATCAAATTTTATTCGATGGTTGATAATAAATCATACCCAATAGCTATACCAACTTCA
GCTGAGTTAGAAAAGTTTGAAAAACATATTCAAACAATCAAGCAATATAATCCAATGGATAACTCATTTA
GGCAAAATATTGAAAAGTGTAAATTTTGTATATATGCAAACTTATGTGATAAAACGGACTTGTAG
>AJJ46478.1 contig_ID:CP010103.1 Gene_location:573007-574011 direction:+ Annotation:what=cas;des=cd09634:cas1;note=universal;Name=AJJ46478.1;gene=cas1
ATGTTTAGTAAAAATGATATTGAATCAAAGAATATAGTTTTTGTTAATATTTTTGATGGAGTGAAACTTA
GTCTATCATTGGGGAATATAGTTATAAAAGATAAAGAAACTGATGAGGTGAAAACTAAGCTTTCTGTTCA
TAAAGTTCTTGCATTGTTTATCGTAGGTAATATGACGATGACCTCGCAACTTTTAGAGACCTGTAAGAAA
AATGCTATACAGCTAGTTTTTATGAAAAATAGCTTTAGACCATATCTATGTTTTGGTGATATTGCTGAGG
CTAATTTTTTAGCTAGATATAAGCAATATAGTGTAGTTGAGCAAGATATAAGTTTAGCAAGGATTTTTAT
AACATCAAAGATACGCAATCAACATAACTTAGTCAAAAGCCTAAGAGATAAAACTCCAGAGCAGCAAGAG
ATAGTCAAAAAGAATAAACAGCTAATAGCAGAGTTAGAAAATACAACAAGCCTAGCGGAGCTAATGGGTA
TAGAGGGCAATGTTGCCAAAAATTTCTTCAAAGGATTCTATGGACATTTAGATAGTTGGCAAGGGCGCAA
ACCTAGAATAAAACAGGATCCATATAATGTTGTTTTAGACTTGGGCTATAGTATGTTGTTTAATTTTGTA
GAGTGTTTTTTGCGACTTTTTGGCTTTGATTTATACAAGGGCTTTTGTCATCAAACTTGGTATAAGCGTA
AATCCCTAGTTTGTGACTTTGTTGAGCCATTTAGATGTATAGTGGATAACCAAGTTAGAAAATCATGGAA
TCTCGGGCAATTTTCTGTAGAGGATTTTGGTTGCAAAAATGAGCAGTTTTATATAAAAAAAGATAAAACA
AAAGACTACTCAAAAATACTTTTTGCCGAGATTATCAGCTACAAGCTAGAGATATTTGAATATGTAAGAG
AATTTTATCGTGCCTTTATGCGAGACAAAGAAATTGCAGAGTATCCAATATTTTGTTATGAAACTAGGAG
GGTGTATGTTGATAGTCAGTTATGA
>AJJ47322.1 contig_ID:CP010103.1 Gene_location:573992-574264 direction:+ Annotation:what=cas;des=pfam09827:cas2;note=universal;Name=AJJ47322.1;gene=cas2
ATGTTGATAGTCAGTTATGATTTTAGTAATAATAAAGTACGTGCAAAGTTTGCCAAATTTCTAGAAAGTT
ATGGTGTACGTTTACAATATTCGGTATTTGAGCTCAAATATAGCAAGAGAATGTTAGACTTGATTTTAGC
TGAGATAGAAAATAACTATGTACCACTATTTACAAATGCTGATAGTGTTTTAATCTTTAATGCTCCAGAT
AAAGATGTGATAAAATATGGTTATGCGATTCATAGAGAACAAGAGGTTGTTTTTATAGACTAA
>AJJ47963.1 contig_ID:CP010103.1 Gene_location:1293410-1294402 direction:+ Annotation:what=cas;des=pfam00078:RT;note=other;Name=AJJ47963.1;gene=unk
ATGGATTTTTTCTTTTTAGGTTTAGAAGAGTCACTTGGTAGTGATAATAAGTTTGTAAAACTAAACAAGT
TAGTTAACTTTGAAAAGTTTAGGAAAACACTTAAAGGTATCTATACACAAGATATGACAAGGCAAGGTAG
ACCCGCCTATGATTGTATAATGATGTTTAAACTTTTGTTACTAGGACAGTGGTATAGTCTAAGTGATAGA
GAATTAGCCTCTAGTTTAAGGCTAAGAATTGATTTCATGTATTTCACAGGTTTTACGCCAACATCTAACT
TACCTGATTATAGTACTGTTAATAAGTTTAGAAACTTATTAATAGAAAAGAAAAAATATAAAAGGCTACT
TAAAGAATTTAACAAACAGCTAGAAGCATTAGGGTTATCGATAAATAATGCCAAAGGTGCAATTATAGAT
GCTACCTTAGTTGAGTCTGCAGGCAGACCTAATAAACATATTGATAATCCAGTAGAAGATAGAAAAGAAG
ACAAAACCTCTATTCCTAATATTTCATATGGTAAAGATACAGATGCAAGATGGATTAAGAAAGGTAGTAA
GAGTCATTATGGCTATAAAGTTTTTGCTAGTGTAGATAATAAGCATGGTTTCATACAAACACTACATACA
GAGTCAGCAGAAGTCTATGAGGCTCATAGATTAGAAACAATGTTAGAAGATATTAATTGTAAACATCTAT
TAGCAGATAAGGCATATGATACTGCTGCTAATAGAGATTTACTAAAAGCTAACAAAATTAATAATCGTGT
ACTTAAAAAAGCAGTTAGAAATAAACCACTAACTAAAAGACAAAAATTACGAAACATTCTTATATCTAAA
ATTAGATATAAGGTTGAACAATGCTTTGGCACGATGAAAAGGAAGTTTAACTTTGCTAGAGCTAGTTACT
TTTCTACAGTAAAAGTAAATGCACAAGCTTTGTTAAAAGCTATATGTTTTAACGCTTTAAAAGCTGTAAA
TTTAATCGCTTAA
>AJJ47946.1 contig_ID:CP010103.1 Gene_location:1294520-1295020 direction:- Annotation:what=cas;des=cd09637:cas4;note=Subtype-II-B;Name=AJJ47946.1;gene=cas4
ATGGACATATTTGATAATGATTTATCTATTCCTGTTAATTTAATTAGACAATGGTGTTTTTGTCCGAGAA
TAGTTTATTATCAAGAACTTCTTGCGATTAAGCCGAACAAACCATTATGGGTTGCTCAAGGTGAAGAATT
TCATAAAAAAGTAGAGCAACTTGAGAAAAGACGCAGCTTTAGCAGATATGGTTTAGAGAATGCGATCAGG
CATTTTAATCTAAGTATAAAAAGTCAGAAATATAAACTACATGGTATAGTTGACTGGGTTATAGAAACTG
ATACTAATGTATATGTGGTTGAGTATAAGACAAATCCTAATCCAAATAGTTTAGGACATAAACTACAAAT
TGCAGCTTATGCTTTGCTAGTACAGGAATATTTTGCTAAACCATGTAAAATTACATTTCTAACCTCTGAT
AAAAAATCATATGAGATAAAAATAACTGATGAGTTAATCAACAAACTTATAAAAACTATCAGTGAAAGGC
TGTTGAGTTAA
>AJJ47599.1 contig_ID:CP010103.1 Gene_location:1295007-1295300 direction:- Annotation:what=cas;des=pfam09827:cas2;note=Subtype-II-B;Name=AJJ47599.1;gene=cas2
ATGCAATTAAGAAAAGAATATTTAATAGCCTATGATATAGAAGATAACAAAACAAGAACAATAATCTATA
AACAACTTCTAGCGTATGGTCTTAAGGCGGTGCAAAAATCAGTATTTTGGGGCTATGTCAGTATTGCTGA
GCTTAATGCTATCAAAAGATTGTTTGATAGCTCATTAACTATTTCAGATAAGGTATTTATTACTAGAGTA
AATATGCATGAGCAAAAACTAGATTATAGCTTTGGTTACGATGACAAAACTTTCAAAGACTGGGATGAAT
ATGGACATATTTGA
>AJJ47478.1 contig_ID:CP010103.1 Gene_location:1295458-1296414 direction:- Annotation:what=cas;des=pfam01867:cas1;note=Subtype-II-B;Name=AJJ47478.1;gene=cas1
ATGAAACATCTAATAATTAGTGAATACGGTATATATCTTGGTTTAGAGTCTGGCAGATTAGTTGTCAAAA
ATAAAGATGATAAAAAGTATTTTCCATTAAATCGTTTAGCTACGCTTTCTATAGCTAAAAAGGGTGTCAG
TTTCTCTAGTGATTTAGTAGAGCAGTTTTCTCTGAGGGGGATTAAACTTTTCTTTTTGGATTTTAGAGGA
GTTGCTCACTCGATGCTTGTTGGTGCTAATCAACATGCTGTAGTTCAAGCACGGATTAACCAATATCGCT
ATATTGATAGAAATGCTTTAACATTGTCAATCAAACTAATTGCAGCTAAAATAAAAAATCAACGTGCTAC
ACTTAACTATTTTAATAAACATCATAAGTCAATAAATCTTCTAAATGCTATAGAAGAGCTAAAAAGAGTA
GCACAACTTATCAAAAATGCTAAAACTCTAAATGATGTACTTGGTTACGAGGGTTATGCGGCTAATATAT
ATTTTTCAAGTTTGGCTAAAGATAAATTTTTATCAGCGAGTTTTGCCAATAGGGAGGGTCGAGGCTCTCA
GGAGATTGCCAATAGTATGCTAAATTTTGGTTATGCTATCTTATCTAGCTATATTCTAAATGCAATTACA
AATGCAGGACTTGAGCCTTATTTAGGATTTTTACATCAAAAGAGACCTGGAAAGATGTCGTTAGTTTTAG
ATCTAATGGAGGAGTATCGAGCTTGGGTCGTTGATAGGGTAGTTATTAAGTTACGCGAACAATATAAGAA
TAAGCAATATATAGATACTAAATTAAAATCGATACTAATCTCAGAGATACAAGCAACGATAGCAAAGAAA
TATATTTATAATGGTAAAAAACTTAAGTTAGAACACATTATCCAAAGGCAGGTATATAGATTATCTGGAG
AATTTGCTGGTGAACATAATTATAAACCGTATATTTTTAAGTGGTAG
>AJJ46981.1 contig_ID:CP010103.1 Gene_location:1296395-1301284 direction:- Annotation:what=cas;des=cd09704:cas9;note=Subtype-II-B;Name=AJJ46981.1;gene=unk
ATGAATGTCAAAATATTGCCAATAGCAATAGATTTAGGTGTTAAAAATACTGGTGTCTTTAGCGCATTTT
ATCAAAAAGGAACTTCTCTTGAGAGATTGGATAATAAAAATGGCAAAGTATATGAACTATCAAAAGATTC
TTATACTTTATTAATGAATAATAGAACAGCAAGAAGACATCAAAGAAGAGGAATAGATAGAAAGCAGCTA
GTCAAAAGGCTCTTTAAGCTTATTTGGACAGAGCAGCTAAATTTAGAGTGGGATAAAGACACTCAACAAG
CTATTAGCTTTTTGTTTAATCGTAGAGGTTTTAGTTTTATTACTGATGGTTATTCGCCTGAATATTTAAA
TATTGTTCCAGAGCAAGTAAAAGCGATACTTATGGATATATTTGATGATTACAACGGTGAAGATGATTTA
GACAGTTATTTAAAATTAGCTACTGAGCAAGAAAGCAAAATTTCTGAAATATATAACAAGCTAATGCAAA
AAATATTAGAGTTTAAATTAAGGAAATTATGTACTGATATTAAGGATGATAAAGTAAGTACTAAAACACT
TAAAGAAATCACAAGCTATGAATTTGAGTTATTAGCTGATTATTTAGCAAACTATAGCGAGATTTTAAAA
ACACAAAAATTTAGTTATACAGATAAACAAGGTAATTTAAAAGAGCTAAGCTACTATCATCATGATAAAT
ATAATATTCAAGAATTTCTAAAGCGACATGCTACTATAAATGATGAAATTTTAGATACTCTTTTAACTGA
TGATTTAGATATTTGGAATTTTAATTTTGAGAAATTTGATTTTGATAAGAATGAAGAAAAGCTTCAGAAT
CAGGAAGATAAAGATCATACACAAGCGCATTTACATCATTTTGTTTTTGCAGTAAATAAAATAAAAAGTG
AAATGGCAAGTGGTGGTCGTCATCGTGGCCAATATTTTCAAGAGATAACAAATGTGCTAGATGAAAATAA
TCATCAAGAGGGATATCTCAAGAATTTCTGTGAAAATTTGCATAATAAAAAATATTCAAATTTAAGTGTT
AAAAATTTAGTCAATCTAATTGGTAACCTAAGTAATTTAGAGCTAAAACCGCTAAGAAAATACTTTAATG
ACAAAATTCACGCAAAAGCTGATCATTGGGATGAGCAAAAGTTTACAGAAACTTATTGCCACTGGATATT
AGGAGAGTGGCGAGTAGGTGTCAAAGATCAAGATAAGAAAGATGGCGCTAAATATAGTTATAAAGATCTG
TGTAATGAATTAAAACAAAAAGTTACTAAGGCTGGTTTGGTAGATTTTTTATTAGAGTTAGATCCATGTA
GAACTATACCACCATATCTGGATAACAATAACCGTAAACCACCAAAATGTCAAAGTTTGATTTTAAATCC
GAAGTTTTTAGATAATCAATATCCAAACTGGCAACAATATTTACAAGAATTAAAGAAATTACAAAGTATT
CAAAATTATTTAGAAAGTTTTGAAACTGATTTAAAAGTCTTAAAGTCAAGTAAAGATCAACCATATTTTG
TTGAATACAAGAGTTCAAATCAGCAAATAGCAAGTGGTCAAAGAGATTATAAAGATTTAGATGCTCGAAT
ATTACAGTTTATATTTGATAGGGTAAAAGCTAGTGATGAGTTGCTTTTGAATGAGATTTATTTTCAGGCT
AAAAAACTTAAACAAAAAGCTAGCTCTGAGTTAGAAAAACTCGAGTCGAGCAAAAAGCTAGATGAAGTTA
TAGCAAATAGTCAACTATCACAGATACTAAAGTCTCAACATACAAATGGTATTTTTGAACAGGGTACTTT
TTTGCATTTGGTTTGTAAATATTATAAACAAAGACAAAGAGCGAGAGACTCTAGGCTATATATTATGCCT
GAATATCGTTATGATAAAAAACTAGATAAATATAACAATACAGGCAGGTTTGATGATGATAATCAGCTGC
TAACATATTGTAATCATAAGCCAAGACAAAAAAGATACCAATTGTTAAATGATTTAGCTGGGGTGTTGCA
GGTATCACCTAATTTTTTGAAAGATAAAATTGGTTCTGATGATGATCTATTTATTAGCAAATGGTTGGTA
GAGCATATTAGAGGATTTAAAAAAGCTTGTGAAGATAGTTTAAAAATACAAAAAGACAATAGAGGATTAT
TAAATCATAAAATAAATATAGCTAGGAATACAAAAGGCAAATGTGAAAAAGAAATATTTAATTTAATATG
TAAAATAGAAGGTTCAGAAGATAAAAAAGGTAATTACAAGCATGGTTTAGCTTACGAATTAGGAGTACTT
TTATTTGGTGAACCTAATGAAGCTAGTAAACCTGAGTTCGATAGGAAAATTAAAAAATTTAACTCAATAT
ATAGTTTTGCACAGATTCAACAAATTGCTTTTGCAGAGCGTAAAGGTAATGCTAACAGTTGTGCAGTTTG
TAGTGCTGATAATGCTCATAGAATGCAACAAATTAAGATCACTGAGCCTGTAGAGGACAATAAAGATAAG
ATAATCTTAAGTGCCAAAGCTCAGAGACTACCAGCGATTCCAACTAGAATAGTTGACGGTGCGGTTAAGA
AAATGGCAACTATATTAGCTAAAAATATAGTTGATGATAATTGGCAGAATATCAAACAAGTTTTATCAGC
AAAACATCAGTTACATATACCTATTATCACAGAATCAAATGCTTTTGAGTTTGAACCAGCATTAGCTGAT
GTAAAAGGTAAGAGCATAAAAGATAGGAGAAAAAAAGCATTAGAGAGAATAAGTCCTGAAAATATATTCA
AGGATAAAAACAATAGAATAAAAGAATTTGCTAAAGGTATATCAGCATATAGTGGCGATAATTTAGCGAG
TGGCGATTTTGATGGTGCAAAAGAAGAATTAGATCATATAATACCTCGTTCACATAAAAAATACGGTACT
CTAAATGATGAAGCAAATCTAATTTGTGTAACTCGTGATGATAATAAAAATAAAGGTAATAGAATTTTCT
GCCTACATGATCTTGCAAATAACTATAAACTAAAACAGTTTGAGACAACTGATGATTTGGAAATTGAAAA
GAAGATAGCTGATACAATCTGGGATGCTAGCAAGAAAGATTTTAAATTTGGTAATTATCGTAGTTTTATT
AACCTAACACCACAAGAGCAGAAAGCATTTCGTCACGCGCTATTTCTGGCTGATGAAAATCCTATCAAAC
AAGCAGTCATAAGGGCGATAAATAATCGTAATCGTACATTTGTAAATGGCACTCAACGCTATTTTGCAGA
AGTACTGGCAAACAATATCTATCTAAGAGCTAAAAAAGAAAATCTAAATACAGATAAAATTTCATTTGAT
TATTTTGGTATTCCAACTATAGGTAATGGTAGAGGTATTGCTGAAATCCGTCAACTTTATGAAAAAGTTG
ATAGTGATATACAAGCTTATGCAAAAGGTGATAAACCTCAAGCTAGCTACTCTCACCTAATAGATGCGAT
GCTGGCTTTTTGTATTGCTGCTGATGAACACAGAAATGATGGAAGTATAGGTCTAGAAATCGATAAAAAT
TATAGTTTATATCCATTAGATAAAAATACAGGAGAAGTCTTTACCAAAGATATTTTTAGTCAAATTAAAA
TTACTAATAATGAGTTTAGCGATAAAAAATTAGTAAGAAAAAAAGCTACAGAGGGCTTTAACACGCATAG
ACAAATGACTAGAGATGGCATTTATGCAGAAAATTACCTACCAATACTAATCCATAAAGAACTAGATGAA
GTTAGAAAAGGCTATACTTGGGGAAATAGTGAAGAACTAAAGATTCATAAAGGTAAAAAGTACGATATAC
AACAATTAAATAACCTTGTGTATTGTCTAAAATTTATAGATAAATCTATATCTATAGATATACAAATTAG
TACCTTAGAAGAGTTAAGAAATATATTAACAACAAATAATATAGCTACTACAGCAGAATACTATTATATA
AATCTAAAAACCCAAAAATTACATGAGTATTATATCGAAAACTATAATACTGCCTTAGGTTATAAAAAAT
ACACTAAAGAAATGGAGTTTTTGAGAAGCTTAGCTTATCGTAGCGAAAGGGTAAAAATTAAATCAATAGA
TGATGTAAAGCAGGTTTTGGATAAGGATAGTAACTTTATCATCGGTAAGATTACTTTACCATTTAAAAAA
GAGTGGCAAAGACTATATCGTGAGTGGCAAAATACAACTATCAAAGATGATTATGAGTTTTTAAAATCAT
TCTTTAATGTTAAAAGTATTACTAAGTTGCATAAAAAAGTTAGAAAAGATTTCTCTTTACCTATTTCTAC
AAATGAAGGTAAATTCCTGGTCAAAAGAAAAACATGGGATAACAATTTTATCTATCAGATATTAAATGAT
TCTGATTCTAGAGTAGACGGAACAAAGCCATTTATTCCAGCTTTTGATATTTCTAAAAATGAAATAGTCG
AAGCCATAATTGATTCATTTACATCAAAAAATATTTTTTGGCTGCCTAAAAATATAGAATTACAAAAGGT
GGATAATAAAAACATTTTTGCTATAGATACTAGTAAATGGTTCGAAGTAGAAACACCTAGTGATCTTAGA
GACATTGGAGTAGCAACAATTCAATACAAGATAGATAATAATTCTCGCCCTAAAGTCAGAGTTAAACTTG
ATTATGTTATCGATGATGATAGTAAGATAAATTATTTTACGAATCATTCTTTATTAAAATCAAGATATCC
TGACAAAGTTTTAGAAATTTTAAAACAATCAACTATTATAGAATTTGAAAGTTCAGGTTTTAATAAAACT
ATCAAAGAAATGCTTGGTATGACATTAGCAGGTATTTATAATGAAACATCTAATAATTAG
>AJJ47970.1 contig_ID:CP010103.1 Gene_location:1301751-1302743 direction:+ Annotation:what=cas;des=pfam00078:RT;note=other;Name=AJJ47970.1;gene=unk
ATGGATTTTTTCTTTTTAGGTTTAGAAGAGTCACTTGGTAGTGATAATAAGTTTGTAAAACTAAACAAGT
TAGTTAACTTTGAAAAGTTTAGGAAAACACTTAAAGGTATCTATACACAAGATATGACAAGGCAAGGTAG
ACCCGCCTATGATTGTATAATGATGTTTAAACTTTTGTTACTAGGACAGTGGTATAGTCTAAGTGATAGA
GAATTAGCCTCTAGTTTAAGGCTAAGAATTGATTTCATGTATTTCACAGGTTTTACGCCAACATCTAACT
TACCTGATTATAGTACTGTTAATAAGTTTAGAAACTTATTAATAGAAAAGAAAAAATATAAAAGGCTACT
TAAAGAATTTAACAAACAGCTAGAAGCATTAGGGTTATCGATAAATAATGCCAAAGGTGCAATTATAGAT
GCTACCTTAGTTGAGTCTGCAGGCAGACCTAATAAACATATTGATAATCCAGTAGAAGATAGAAAAGAAG
ACAAAACCTCTATTCCTAATATTTCATATGGTAAAGATACAGATGCAAGATGGATTAAGAAAGGTAGTAA
GAGTCATTATGGCTATAAAGTTTTTGCTAGTGTAGATAATAAGCATGGTTTCATACAAACACCACATACA
GAGTCAGCAGAAGTCTATGAGGCTCATAGATTAGAAACAATGTTAGAAGATATTAATTGTAAACATCTAT
TAGCAGATAAGGCATATGATACTGCTGCTAATAGAGATTTACTAAAAGCTAACAAAATTAATAATCGTGT
ACTTAAAAAAGCAGTTAGAAATAAACCACTAACTAAAAGACAAAAATTACGAAACATTCTTATATCTAAA
ATTAGATATAAGGTTGAACAATGCTTTGGCACGATGAAAAGGAAGTTTAACTTTGCTAGAGCTAGTTACT
TTTCTACAGTAAAAGTAAATGCACAAGCTTTGTTAAAAGCTATATGTTTTAACGCTTTAAAAGCTGTAAA
TTTAATCGCTTAA