##gff-version 3
#!processor CRISPRone
CP010103.1	Genbank	region	1	2005074	.	+	.	ID=CP010103.1;array=2;gene=10;type=(type II, V)
CP010103.1	FGS-hmm	CDS	568439	572341	.	+	.	what=cas;des=mkCas0192:cas12a;note=Subtype-V-A;Name=AJJ47668.1;gene=unk
CP010103.1	FGS-hmm	CDS	572449	573003	.	+	.	what=cas;des=cd09637:cas4;note=other;Name=AJJ46892.1;gene=unk
CP010103.1	FGS-hmm	CDS	573007	574011	.	+	.	what=cas;des=cd09634:cas1;note=universal;Name=AJJ46478.1;gene=cas1
CP010103.1	FGS-hmm	CDS	573992	574264	.	+	.	what=cas;des=pfam09827:cas2;note=universal;Name=AJJ47322.1;gene=cas2
CP010103.1	metaCRT	direct_repeat	574404	575286	.	.	.	what=CRISPR;des=repeat:GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT;note=copy:14
CP010103.1	metaCRT	direct_repeat	1292328	1292866	.	.	.	what=CRISPR;des=repeat:GTTTCAGTTGCTGAATTATTTGGTAAACTACTGTTAG;note=copy:8
CP010103.1	FGS-hmm	CDS	1293410	1294402	.	+	.	what=cas;des=pfam00078:RT;note=other;Name=AJJ47963.1;gene=unk
CP010103.1	FGS-hmm	CDS	1294520	1295020	.	-	.	what=cas;des=cd09637:cas4;note=Subtype-II-B;Name=AJJ47946.1;gene=cas4
CP010103.1	FGS-hmm	CDS	1295007	1295300	.	-	.	what=cas;des=pfam09827:cas2;note=Subtype-II-B;Name=AJJ47599.1;gene=cas2
CP010103.1	FGS-hmm	CDS	1295458	1296414	.	-	.	what=cas;des=pfam01867:cas1;note=Subtype-II-B;Name=AJJ47478.1;gene=cas1
CP010103.1	FGS-hmm	CDS	1296395	1301284	.	-	.	what=cas;des=cd09704:cas9;note=Subtype-II-B;Name=AJJ46981.1;gene=unk
CP010103.1	FGS-hmm	CDS	1301751	1302743	.	+	.	what=cas;des=pfam00078:RT;note=other;Name=AJJ47970.1;gene=unk