Table: a summary of the spacer graphs derived from the CRISPR arrays identified in long reads (SRR2822456).
Group: groups of CRISPR arrays sharing spacers;
Graph (spacer graph): pdf -- to see/download spacer graph in pdf format; dot -- to show the dot file of the graph; array -- to show the spacer arrays;
Representative seq: click on representative sequence to see the CRISPR-cas annotation of that sequence;
CRISPRdirect: the direction prediction by CRISPRdirect; confidence -- CRISPRdirect prediction confidence; consistent/opposite -- if the CRISPRdirect predicted orientation is consistent or opposite to our prediction.
Representive seqs:
Note: One spacer (#2) is shared by two groups of arrays repeats: (similar) GTCGCACTCTCACGAGTGCGTGGATTGAAAC (SRR2822456.1066806) GTCGCACCCTCACGGGTGCGTGGATTGAAAC (SRR2822456.69522) shared spacer #2 (identical): CTCCAACGGCGTCCAACTGGTGCATGTCATCCAG No adjacent cas genes. This graph can be split into two as shown in group11a and group11b, see below